HIGHLIGHTS
- who: PLANT PHYSIOLOGY from the Ghent University have published the paper: And . . . cut! Identifying chromatin features affecting CRISPR-Cas9 activity in plants, in the Journal: (JOURNAL) of June/28,/2022
SUMMARY
Identifying chromatin features affecting CRISPR-Cas9 activity in plants PLANT PHYSIOLOGY 2022: 190; 1074-1076 Chromatin features affecting CRISPR activity # REPEATS GC% EASY GENOTYPING Cas9 + H3K9ac H3K36ac H3K36me3 1 gRNA GTTTTCTCGCACTTAAGCTCTGG CHROMATIN CONTEXT 1 GUIDE RNA 7 MULTICOPY 8 TARGET SITES CRISPR SITES 8 DIVERSE CHROMATIN CONTEXTS DNA C-me H2A.W H3K9me1 H3K9me2 Arabidopsis plants. The sequence of the DNA flanking . . .
If you want to have access to all the content you need to log in!
Thanks :)
If you don't have an account, you can create one here.