Aav-delivered diacylglycerol kinase dgkk achieves long-term rescue of fragile x syndrome mouse model

HIGHLIGHTS

• who: Karima Habbas and colleagues from the was performed with the aim of ensuring that discomfort, distress, pain, and injury would be minimalCloning of human and mouse DGKk mRNA Mouse DGKk was subcloned from clone IMAGE IRAVp H D. The missing , UTR and , UTR-N-ter region were cloned by PCR from mouse genomic DNA with primer sets (GCAGCTAGCTCCTTGAAAGCTGGAAGGAGA and AATAGAATGCGGCC-GCCAGCTTCA ACAGCACTTGTAG) and (CCAgtcgacTTAGACCTCAGAGCTGC GCTAGC and CCAgctagcCCAGGACTCTGGGGCCCTCTCCAT), respectively. The , UTR region was introduced at XbaI and NotI sites of the pYX-u0394N DGKk vector to give pYX-u0394N-DGKj, UTR, and the , UTR-Nter region at . . .
  

   

  

  If you want to have access to all the content you need to log in!

  Thanks :)

  Username or Email

  Password

  Remember me

  Lost your password?

  If you don't have an account, you can create one here.