Allostery between two binding sites in the ion channel subunit trip8b confers binding specificity to hcn channels

HIGHLIGHTS

• who: Kyle A. Lyman from the Throughout the manuscript, TRIP8b residues are referred to using the, a, isoform as a referenceTRIP8b, , was generated using PCR amplification of the TRIP8b insert from a plasmid template using, u2b18 atagcgccatggctcggctgacc, u2b18 and, u2b18 cgccgcctcgagcccgggtcaaggatccaaattgaaag, u2b18 followed by Nco1/ Xho, digestion and ligated into a modified pGS21a bacterial expression vector (described previously (33)). The CNBD fragment used in our study (CNBD443-, ) has been referred to previously as HCN J (34) and spans residues, of the mouse , isoform with a maltose-binding protein tag (a generous gift from Dr. Eric Accili, University . . .
  

   

  

  If you want to have access to all the content you need to log in!

  Thanks :)

  Username or Email

  Password

  Remember me

  Lost your password?

  If you don't have an account, you can create one here.