HIGHLIGHTS
- who: Claudia Rifici and colleagues from the Department of Veterinary Sciences, University of Messina, via GPalatucci, Messina, Italy have published the research: An Unusual Case of Collision Testicular Tumor in a Female DSD Dog, in the Journal: (JOURNAL)
- what: The relation between DSD and neoplastic processes is common in humans [36], but there is little data relating to dogs.
SUMMARY
L GCACCACTTTGGGCTCCTTC 67,428,473 Fragment Size T◦ 0 0 CFA-SRY-F2 GCAGGTGCACGTAGATGAGA ChrY: Genome Pos Gene Primers Sequence (bp) Annealing Sry 142 57° 1,350,170- CFA_SRY_Short_R3 TGTGGTACTCCTGTTGCAG U . . .
If you want to have access to all the content you need to log in!
Thanks :)
If you don't have an account, you can create one here.