HIGHLIGHTS
- who: Anna Masato from the pHT2u03b1Syn-HaloTag for cell line transfection were generated in Prof. Bubacco`s lab (UNIPD) by cloning the u03b1Syn-encoding sequence into the pEGFP-, empty vector (Novagen) and the p, vector, respectively, previously described24, . The u03b1Syn K R variant was generated using the Quick-Change II sitedirected mutagenesis kit (Stratagene) according to manufacturer`s instructions, using the following primers: FOR:, ` ATTGGCTTTGTCAGAAAGGACCAGTTGG, ` have published the Article: DOPAL initiates u03b1Synuclein-dependent impaired proteostasis and degeneration of neuronal projections in Parkinsonu2019s disease, in the Journal: (JOURNAL) of 22/09/2010
- what: The authors aimed . . .

If you want to have access to all the content you need to log in!
Thanks :)
If you don't have an account, you can create one here.