Eltanexor effectively reduces viability of glioblastoma and glioblastoma stem-like cells at nano-molar concentrations and sensitizes to radiotherapy and temozolomide

HIGHLIGHTS

• who: Katharina Otte and collaborators from the Department of Neurosurgery, Philipps University Marburg, Baldingerstrasse, Marburg, Germany have published the article: Eltanexor Effectively Reduces Viability of Glioblastoma and Glioblastoma Stem-like Cells at Nano-Molar Concentrations and Sensitizes to Radiotherapy and Temozolomide, in the Journal: Biomedicines 2022, 2145 of 31/08/2022
• what: The major goal of this work was to evaluate the therapeutic efficacy of Eltanexor in GBM cell lines and especially GBM stem-like cells.
• how: For the housekeeping control gene the authors used RPLP0 XS13fw 50 -TGGGCAAGAACACCATGATG-30 XS13rev 50 AGTTTCTCCAGAGCTGGGTTGT . . .
  

   

  

  If you want to have access to all the content you need to log in!

  Thanks :)

  Username or E-mail:

  If you don't have an account, you can create one here.