Eukaryotic translation initiation factor 4g (eif4g) coordinates interactions with eif4a, eif4b, and eif4e in binding and translation of the barley yellow dwarf virus 3⠲ cap-independent translation element (bte)*

HIGHLIGHTS

• who: Pei Zhao from the Plasmid construction eIF, recombinant protein expression construct was a generous gift from DrD. R. Gallie (University of California, Riverside, CA). The construct was made as described (29). Plasmid pGEX- TK was used for expression of eIF, and eIF, . The DNA fragments were generated by PCR from eIF G full-length cDNA template (a generous gift from Dr. Karen Browning, University of Texas, Austin, TX). Forward primer includes a BamHI site in the, ⬘ end, followed by the eIF G ORF (forward primer for eIF, : TTAAGGGATCCAAGAAGAAACGGAAGG (eIF G ORF sequence underlined) have published the . . .
  

   

  

  If you want to have access to all the content you need to log in!

  Thanks :)

  Username or Email

  Password

  Remember me

  Lost your password?

  If you don't have an account, you can create one here.