Induction of cpla2 in lung epithelial cells and non-small cell lung cancer is mediated by sp1 and c-jun*

HIGHLIGHTS

• who: Stacy A. Blaine from the Reagents and Constructs-The c, promoter construct contains , kilobase pairs of the, ⬘ region ligated into the promoterless luciferase vector PA3-Luc (16). The truncation mutant encoding the region from ⫺, to ⫹, (16) was used to generate additional truncations by polymerase chain reaction as described previously (14). Mutations within this region were generated using the QuikChange site-directed mutagenesis kit (Stratagene). The following primers were used with mutations underlined in bold: mutation ⫺55/⫺, sense primer, CTGGATCCCGGGTACCGTTTTAACATCCACAGAGACCAG have published the paper: Induction of cPLA2 in Lung Epithelial Cells and Non-small Cell Lung Cancer . . .
  

   

  

  If you want to have access to all the content you need to log in!

  Thanks :)

  Username or Email

  Password

  Remember me

  Lost your password?

  If you don't have an account, you can create one here.