HIGHLIGHTS
- who: Oligopeptide transporter PepT and collaborators from the given in the morning (08:00) by hand, in small quantities until the fish ceased to respond have published the article: PepT1 mRNA expression levels in sea bream ( Sparus aurata ) fed different plant protein sources, in the Journal: (JOURNAL)
- what: Table 2 Sequences of the primers used in the work Primer Sequence 50 - 30 Purpose PepT1-sense1 GATGACTTCGCCACCACTA RT-PCR PepT1-antisense1 CGATCAGATGCAGACGGTG RT-PCR PepT1-sense2 AGCAGGGCTCAAGATGGAC RT-PCR PepT1-antisense2 ACATCATCGTGCTCATCGTG RT-PCR PepT1_T7promoter gtaatacgactcactataggg GGAGTGTGGTATTCACA mRNA std.curve PepT1_antisense3 AGCAGGGCTCAAGATGGAC mRNA std.curve PepT1 . . .

If you want to have access to all the content you need to log in!
Thanks :)
If you don't have an account, you can create one here.