HIGHLIGHTS
- who: Fengling Lai and colleagues from the Homozygous Rnf Flox/Flox mice were crossed with transgenic mice expressing the CRE recombinase under the control of the Amh promoter to generate the Rnf Flox/Flox and the Amh-Rnf20-/- mice [45]PCR primers were used for genotyping of the Rnf, and the Amh mice as follows: Rnf20:, ` GCTGTAAGAGTTCTTAATGTATG, ` and, ` GGCTTGTCACACAAGCATGAGCATC, ` have published the Article: RESEARCH Open Access, in the Journal: (JOURNAL)
- what: The study provides a mouse model of the Rnf20 knockout, that recapitulates the Sertoli cellonly syndrome in humans, a serious condition for male infertility . . .
If you want to have access to all the content you need to log in!
Thanks :)
If you don't have an account, you can create one here.