HIGHLIGHTS
- who: Chi-Sheng Lu from the (UNIVERSITY) have published the Article: The RING Finger Protein RNF8 Ubiquitinates Nbs1 to Promote DNA Double-strand Break Repair by Homologous Recombination*, in the Journal: (JOURNAL) of December/21,/2012
- how: The shRNA target sequences for Mre11 and Nbs1 were previously described and the following shRNAs were designed by Dharmacon for RNF8sh GGACAAUUAUGGACAACAAGA for MDC1sh GUCUCCCAGAAGACAGUGAUU and for H2AXsh GGGACGAAGCACUUGGUAA.
- future: More recent studies demonstrate that RNF8 and its ubiquitination activity play crucial roles in the DNA damage response.
SUMMARY
MDC1 is recruited . . .
If you want to have access to all the content you need to log in!
Thanks :)
If you don't have an account, you can create one here.